ybx1 protein, mouse, recombinant (TargetMol)

N/A

Buy from Supplier

1999 n a recombinant human ybx1 origene cat (OriGene)

OriGene 1999 n a recombinant human ybx1 origene cat
$Figure 2. Structure of IMP1 and <t>YBX1</t> mRNP Granules (A) HeLa cells were stained with anti-IMP1 and anti-YBX1 antibodies followed by Alexa Fluor 488 (green) and Alexa Fluor 647 (red) secondary antibodies, respectively. (A1–A3) Overview of the cell. Scale bars, 5 mm. (A4–A6) Blow-up of IMP1 and YBX1 granules in the indicated area (white square) in (A3). Scale bar, 0.2 mm. (A7) P bodies depicted by DCP1a-EGFP in combination with IMP1 staining and A8, pHcRed-G3BP in stress granules in combination with IMP1 staining. (B) IMP1 (green, Alexa Fluor 488) and YBX1 (red, Alexa Fluor 647) immunostaining in combination with ACTB mRNA FISH (cyan) using 48 Quasar 570 dye-labeled oligonucleotides corresponding to the entire ACTB mRNA. (B1–B4) Overview of a HeLa cell. Scale bars, 5 mm. (B5–B9) blow up of ACTB mRNA and IMP1_YBX1 containing granules. Scale bars, 0.2 mm (B5) and 0.1 mm (B6–B9). (B10–B19) IMP1 (green, Alexa Fluor 488) and YBX1 (red, Alexa Fluor 647) immunostaining in combination with GAPDH mRNA FISH (cyan) using 48 Quasar 570 dye-labeled (cyan) oligonucleotides corresponding to the entire GAPDH mRNA. (B10–B14) Overview of a HeLa cell. Scale bars, 5 mm. (B15–B19) Blow-up of GAPDH mRNA and IMP1_YBX1 containing granules. Scale bars, 0.2 mm (B15) and 0.1 mm (B16–B19). (B20 and B21) Double FISH with ACTB mRNA (red, Quasar 670-conjugated probes) and GAPDH mRNA (green, Quasar 570-conjugated probes) in combination with YBX1 immunostaining (gray, Alexa Fluor 488). (C) EGFP immunoprecipitation of transiently transfected HeLa cells with pEGFP-C1 (control) and pEGFP-IMP1. Immunodetection of GFP and GFP-IMP1, endogenous IMP1, YBX1, and GADPH, respectively, was performed in total lysate and immunoprecipitated (IP) fractions without () or with (+) RNase A treatment.$
1999 N A Recombinant Human Ybx1 Origene Cat, supplied by OriGene, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/ybx1+recombinant+protein/YB1+(YBX1)+(NM_004559)+Human+Recombinant+Protein/pm31618640-220-74-79
Average 94 stars, based on 1 article reviews

1999 n a recombinant human ybx1 origene cat - by Bioz Stars, 2026-10

94/100 stars

Buy from Supplier

recombinant rat ybx1 protein (Creative BioMart)

N/A

Recombinant Rat YBX1 full length or partial length protein was expressed.http://www.creativebiomart.net/Recombinant-Rat-YBX1-Protein-455449.htm

Buy from Supplier

recombinant mouse ybx1 protein (Creative BioMart)

N/A

Recombinant Mouse YBX1 full length or partial length protein was expressed.http://www.creativebiomart.net/Recombinant-Mouse-YBX1-Protein-448608.htm

Buy from Supplier

ybx1 nm 011732 mouse recombinant protein (OriGene)

N/A

Purified recombinant protein of Mouse Y box protein 1 Ybx1 with C terminal MYC DDK tag expressed in HEK293T cells 20ug

Buy from Supplier

ybx1 protein, human, recombinant (TargetMol)

N/A

Buy from Supplier

human ybx1 recombinant protein (Boster Bio)

N/A

Human YBX1 Recombinant Protein expressed in E. coli with His-tag. Sequence domain: 1-324aa. Application(s): SDS-PAGE.

Buy from Supplier

Image Search Results

$Figure 2. Structure of IMP1 and YBX1 mRNP Granules (A) HeLa cells were stained with anti-IMP1 and anti-YBX1 antibodies followed by Alexa Fluor 488 (green) and Alexa Fluor 647 (red) secondary antibodies, respectively. (A1–A3) Overview of the cell. Scale bars, 5 mm. (A4–A6) Blow-up of IMP1 and YBX1 granules in the indicated area (white square) in (A3). Scale bar, 0.2 mm. (A7) P bodies depicted by DCP1a-EGFP in combination with IMP1 staining and A8, pHcRed-G3BP in stress granules in combination with IMP1 staining. (B) IMP1 (green, Alexa Fluor 488) and YBX1 (red, Alexa Fluor 647) immunostaining in combination with ACTB mRNA FISH (cyan) using 48 Quasar 570 dye-labeled oligonucleotides corresponding to the entire ACTB mRNA. (B1–B4) Overview of a HeLa cell. Scale bars, 5 mm. (B5–B9) blow up of ACTB mRNA and IMP1_YBX1 containing granules. Scale bars, 0.2 mm (B5) and 0.1 mm (B6–B9). (B10–B19) IMP1 (green, Alexa Fluor 488) and YBX1 (red, Alexa Fluor 647) immunostaining in combination with GAPDH mRNA FISH (cyan) using 48 Quasar 570 dye-labeled (cyan) oligonucleotides corresponding to the entire GAPDH mRNA. (B10–B14) Overview of a HeLa cell. Scale bars, 5 mm. (B15–B19) Blow-up of GAPDH mRNA and IMP1_YBX1 containing granules. Scale bars, 0.2 mm (B15) and 0.1 mm (B16–B19). (B20 and B21) Double FISH with ACTB mRNA (red, Quasar 670-conjugated probes) and GAPDH mRNA (green, Quasar 570-conjugated probes) in combination with YBX1 immunostaining (gray, Alexa Fluor 488). (C) EGFP immunoprecipitation of transiently transfected HeLa cells with pEGFP-C1 (control) and pEGFP-IMP1. Immunodetection of GFP and GFP-IMP1, endogenous IMP1, YBX1, and GADPH, respectively, was performed in total lysate and immunoprecipitated (IP) fractions without () or with (+) RNase A treatment.$

Journal: Cell reports

Article Title: Single mRNP Analysis Reveals that Small Cytoplasmic mRNP Granules Represent mRNA Singletons.

doi: 10.1016/j.celrep.2019.09.018

Figure Lengend Snippet: Figure 2. Structure of IMP1 and YBX1 mRNP Granules (A) HeLa cells were stained with anti-IMP1 and anti-YBX1 antibodies followed by Alexa Fluor 488 (green) and Alexa Fluor 647 (red) secondary antibodies, respectively. (A1–A3) Overview of the cell. Scale bars, 5 mm. (A4–A6) Blow-up of IMP1 and YBX1 granules in the indicated area (white square) in (A3). Scale bar, 0.2 mm. (A7) P bodies depicted by DCP1a-EGFP in combination with IMP1 staining and A8, pHcRed-G3BP in stress granules in combination with IMP1 staining. (B) IMP1 (green, Alexa Fluor 488) and YBX1 (red, Alexa Fluor 647) immunostaining in combination with ACTB mRNA FISH (cyan) using 48 Quasar 570 dye-labeled oligonucleotides corresponding to the entire ACTB mRNA. (B1–B4) Overview of a HeLa cell. Scale bars, 5 mm. (B5–B9) blow up of ACTB mRNA and IMP1_YBX1 containing granules. Scale bars, 0.2 mm (B5) and 0.1 mm (B6–B9). (B10–B19) IMP1 (green, Alexa Fluor 488) and YBX1 (red, Alexa Fluor 647) immunostaining in combination with GAPDH mRNA FISH (cyan) using 48 Quasar 570 dye-labeled (cyan) oligonucleotides corresponding to the entire GAPDH mRNA. (B10–B14) Overview of a HeLa cell. Scale bars, 5 mm. (B15–B19) Blow-up of GAPDH mRNA and IMP1_YBX1 containing granules. Scale bars, 0.2 mm (B15) and 0.1 mm (B16–B19). (B20 and B21) Double FISH with ACTB mRNA (red, Quasar 670-conjugated probes) and GAPDH mRNA (green, Quasar 570-conjugated probes) in combination with YBX1 immunostaining (gray, Alexa Fluor 488). (C) EGFP immunoprecipitation of transiently transfected HeLa cells with pEGFP-C1 (control) and pEGFP-IMP1. Immunodetection of GFP and GFP-IMP1, endogenous IMP1, YBX1, and GADPH, respectively, was performed in total lysate and immunoprecipitated (IP) fractions without () or with (+) RNase A treatment.

Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Rabbit anti-IMP1 (raised against C-terminal peptide) Nielsen et al., 1999 N/A Goat polyclonal anti-IMP1 Santa Cruz Biotechnology Cat#E-20; RRID: AB_649425 Rabbit polyclonal anti-YBX1 Abcam Cat#ab12148; RRID: AB_2219278 Rabbit polyclonal anti-GAPDH Santa Cruz Biotechnology Cat#FL-335; RRID: AB_10167668 Mouse monoclonal anti-GFP Abcam Cat#ab1218; RRID: AB_298911 Mouse monoclonal anti-Nup153 Abcam Cat#ab24700; RRID: AB_2154467 Mouse monoclonal anti-PABPC1 Abcam Cat#ab6125; RRID: AB_2156878 Chemicals, Peptides, and Recombinant Proteins Recombinant human IMP1 Nielsen et al., 1999 N/A Recombinant human YBX1 Origene Cat#TP309835 Critical Commercial Assays Click-iT Plus OPP Alexa Fluor 488 Protein Synthesis Assay Kit Invitrogen Cat#C10456 Experimental Models: Cell Lines HeLa cell line ATCC CCL-2 Oligonucleotides siRNA against YBX1 30UTR 50 - GAACAGGCCUGGUGGGAAAUU - 30 (sense) 50 - UUUCCCACCAGGCCUGUUCUU 30 (antisense) Eurofins Genomics N/A Stellaris FISH Probes, Human ACTB with Quasar 570 Dye LGC Biosearch Cat#VSMF-2002-5 Stellaris FISH Probes, Human ACTB with Quasar 670 Dye LGC Biosearch Cat#VSMF-2003-5 Stellaris FISH Probes, Human GAPDH with Quasar 570 Dye LGC Biosearch Cat#SMF-2026-1 Recombinant DNA pEGFP-C1 Clontech N/A pEGFP-IMP1 This manuscript N/A pEGFP-IMP1_KH1-4mut This manuscript N/A pcDNA3.1+N-EGFP-YBX1 Genscript N/A pmCherry-YBX1 This manuscript N/A pmEos3.2-IMP1 This manuscript N/A PABPC1-GFP This manuscript N/A DCP1a-GFP This manuscript N/A pHcRed1-G3BP This manuscript N/A Software and Algorithms ZEN 2012 Carl Zeiss Microscopy N/A RStudio R Foundation N/A

Techniques: Staining, Immunostaining, Labeling, Immunoprecipitation, Transfection, Control, Immunodetection

Figure 3. IMP1 and YBX1 mRNP Formation at the Nuclear Pore HeLa cells were stained with anti-IMP1, anti-YBX1, and anti-NUP153 primary antibodies followed by Alexa Fluor 488 (green), Alexa 555 (cyan), and Alexa Fluor 647 (red) secondary antibodies, respectively. Moreover, the nucleus was stained with DAPI (deep blue). (A) Overview of a triple-stained cell and the area that is shown in the blow-up below. Scale bar, 2 mm. (B–E) Individual IMP1 (B), YBX1 (C), NUP153 (D), and DAPI (E) stainings. (F) Composite picture demonstrating the colocalization of NUP153 and the IMP1_YBX1 mRNP. Scale bar, 200 nm. Arrows indicate nuclear pores.

Journal: Cell reports

Article Title: Single mRNP Analysis Reveals that Small Cytoplasmic mRNP Granules Represent mRNA Singletons.

doi: 10.1016/j.celrep.2019.09.018

Figure Lengend Snippet: Figure 3. IMP1 and YBX1 mRNP Formation at the Nuclear Pore HeLa cells were stained with anti-IMP1, anti-YBX1, and anti-NUP153 primary antibodies followed by Alexa Fluor 488 (green), Alexa 555 (cyan), and Alexa Fluor 647 (red) secondary antibodies, respectively. Moreover, the nucleus was stained with DAPI (deep blue). (A) Overview of a triple-stained cell and the area that is shown in the blow-up below. Scale bar, 2 mm. (B–E) Individual IMP1 (B), YBX1 (C), NUP153 (D), and DAPI (E) stainings. (F) Composite picture demonstrating the colocalization of NUP153 and the IMP1_YBX1 mRNP. Scale bar, 200 nm. Arrows indicate nuclear pores.

Techniques: Staining

Figure 7. Molecular Composition of IMP1_YBX1 mRNP The number of IMP1, YBX1, and ACTB mRNA molecules in the mRNP were derived from localization microscopy (LM) or from FCS and compared with the average number of binding sites in the transcriptome from eCLIP and RNA immunoprecipitation sequencing analysis. For localization microscopy, cells were stained for IMP1, YBX1, and ACTB mRNA, and following bleaching, mRNP emitted photons were counted as described. (A) Examples of the localization microscopy images of YBX1 (red), IMP1 (green), and ACTB mRNA (cyan), respectively. Scale bar, 100 nm. (B) Counts per particle derived from FCS of cells transfected with GFP, GFP-IMP1_KH1-4mut, GFP-IMP1, GFP-YBX1, and with co-transfection of YBX1 30 UTR- directed siRNA and GFP-YBX1. Laser power was 0.02% in all measurements. (C) Summary of the data from localization microscopy, FCS, and binding sites predicted from either eCLIP (IMP1) or RNA immunoprecipitation sequencing (YBX1) experiments. (D) Immunoﬂuorescence staining of PABPC1 (cyan, Alexa Fluor 488), IMP1 (green, Alexa Fluor 568), and YBX1 (red, Alexa Fluor 647). An overview of a whole HeLa cell is shown in the panel above (scale bar, 5 mm), and a blow-up image of the triple PABPC1, IMP1, and YBX1 staining of the area squared in the panel above is shown below (scale bar, 0.2 mm). Positioning of PABPC1 (cyan) in individual mRNPs depicted by YBX1 (red) staining is shown in the panel below (scale bar, 0.1 mm).

Journal: Cell reports

Article Title: Single mRNP Analysis Reveals that Small Cytoplasmic mRNP Granules Represent mRNA Singletons.

doi: 10.1016/j.celrep.2019.09.018

Figure Lengend Snippet: Figure 7. Molecular Composition of IMP1_YBX1 mRNP The number of IMP1, YBX1, and ACTB mRNA molecules in the mRNP were derived from localization microscopy (LM) or from FCS and compared with the average number of binding sites in the transcriptome from eCLIP and RNA immunoprecipitation sequencing analysis. For localization microscopy, cells were stained for IMP1, YBX1, and ACTB mRNA, and following bleaching, mRNP emitted photons were counted as described. (A) Examples of the localization microscopy images of YBX1 (red), IMP1 (green), and ACTB mRNA (cyan), respectively. Scale bar, 100 nm. (B) Counts per particle derived from FCS of cells transfected with GFP, GFP-IMP1_KH1-4mut, GFP-IMP1, GFP-YBX1, and with co-transfection of YBX1 30 UTR- directed siRNA and GFP-YBX1. Laser power was 0.02% in all measurements. (C) Summary of the data from localization microscopy, FCS, and binding sites predicted from either eCLIP (IMP1) or RNA immunoprecipitation sequencing (YBX1) experiments. (D) Immunoﬂuorescence staining of PABPC1 (cyan, Alexa Fluor 488), IMP1 (green, Alexa Fluor 568), and YBX1 (red, Alexa Fluor 647). An overview of a whole HeLa cell is shown in the panel above (scale bar, 5 mm), and a blow-up image of the triple PABPC1, IMP1, and YBX1 staining of the area squared in the panel above is shown below (scale bar, 0.2 mm). Positioning of PABPC1 (cyan) in individual mRNPs depicted by YBX1 (red) staining is shown in the panel below (scale bar, 0.1 mm).

Techniques: Derivative Assay, Microscopy, Binding Assay, RNA Immunoprecipitation, Sequencing, Staining, Transfection, Cotransfection

ybx1 recombinant protein Search Results

Image Search Results